Loading AI tools
Human Y-chromosome DNA haplogroup From Wikipedia, the free encyclopedia
Haplogroup R2, or R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It is one of two primary descendants of Haplogroup R (R-M207), the other being R1 (R-M173).
| Haplogroup R2 | |
|---|---|
.jpg) | |
| Possible time of origin | 27,000 BP[1] |
| Possible place of origin | South Asia or Central Asia[1] |
| Ancestor | Haplogroup R |
| Descendants | R2a (M124); R2b (FGC21706) |
| Defining mutations | M479 |
R-M479 has been concentrated geographically in South Asia and Central Asia since prehistory. It appears to reach its highest levels among the Burusho people in North Pakistan.[2]
It has two primary branches: R2a (M124) and R2b (R-FGC21706)
Source: ISOGG 2017.[1]
Most research has tested only for the presence of R-M479 (R2) and R-M124 (R2a) – or SNPs downstream from M124 like P249, P267, L266, PAGES00004, and L381 SNPs). Because the other primary branch, R2b (R-FGC21706) was discovered later than R2a, it has often not been tested for. Hence most results are best described as R2(xR2a).
In addition, relatively little research has been done within South Asia, which is known to have the greatest concentration of R2. (Hence the figures cited in the table right may not be indicative of true frequencies, i.e. Pakistan is the only South Asian country that has been included.)
In 2013, R2(xR2a) was found in 5 out of 19 males from the Burusho minority of North Pakistan.[2]
Haplogroup R2a (R-M124) is characterized by SNPs M124, F820/Page4, L381, P249,[1] and is mainly found in South Asia, with lower frequencies in Central Asia. R-M124 is also found in multiple Jewish populations: Iraqi Jews, Persian Jews, Mountain Jews, and Ashkenazi Jews.[3]
It is found especially in the Indian subcontinent.[4]
| M479 |
| |||||||||
| Common Name Marker | M479 |
|---|---|
| YCC Haplogroup | R-M479 |
| Nucleotide change | C to T |
| Amplicon size (bp) reference sequence | 323 |
| Polymorphism position from 5' end | 107 |
| Restriction enzyme variant | HphI |
| RefSNP ID | - |
| Y-position | 19294055 |
| Primer forward 5'-3' | gatactttatcaggcttacttc |
| Primer reverse 5'-3' | aaccaaatctctcagaatcg |
Seamless Wikipedia browsing. On steroids.
Every time you click a link to Wikipedia, Wiktionary or Wikiquote in your browser's search results, it will show the modern Wikiwand interface.
Wikiwand extension is a five stars, simple, with minimum permission required to keep your browsing private, safe and transparent.
